View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3951_low_4 (Length: 317)
Name: NF3951_low_4
Description: NF3951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3951_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 43 - 298
Target Start/End: Complemental strand, 53012654 - 53012399
Alignment:
| Q |
43 |
atcaaactttaaaagtaaatatatagaacactttaatattatttagaacttttagtactacccaatagaagaattgtgctttatctcaactcaactnnnn |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53012654 |
atcaaactttaaaagtaaatatatagaacactttaatattatttagaacttttagtactacccaatagaagaattgtgctttatctcaactcaactaaaa |
53012555 |
T |
 |
| Q |
143 |
nnntaggccgtgcgcatgttagatacgtttgttgtctttagcttctttataaatatgggtcttttatgaaagagagatccactcactaaaatgttccatc |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53012554 |
aaataggccgtgcgcatgttagatacgtttgttgtctttagcttctttataaatatgggtcttttatgaaagagagatccactcactaaaatgttccatc |
53012455 |
T |
 |
| Q |
243 |
ttgtctcttctctgttgagaactctattggaataggaagataatgattgtgaagtc |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53012454 |
ttgtctcttctctgttgagaactctattggaataggaagataatgattgtgaagtc |
53012399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University