View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3952_low_1 (Length: 481)
Name: NF3952_low_1
Description: NF3952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3952_low_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 260 - 468
Target Start/End: Complemental strand, 44999350 - 44999146
Alignment:
| Q |
260 |
tagggctcacgaattggagtttatggatcaaattgtcctcagtggattgtggcaatggaggttcccatttctatataacgttctcacatttctttattta |
359 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44999350 |
tagggctcacgaattggagtttatggatcaaattgtcctcagtggattgtggcaatggaggttcccatttctatataacgttctcacattt----attta |
44999255 |
T |
|
| Q |
360 |
tttattttttccttccttctatatatgattgtgttctattataattcataaacttgtttatgttgatgtatgtaggcttgttgcgcccatagcttggttt |
459 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44999254 |
tttattttttccttccttctatatatgattgtgttctattataattcataaacttgtttatgttgatgtatgtaggcttgttgcgcccatagcttggttt |
44999155 |
T |
|
| Q |
460 |
gtgtgcctc |
468 |
Q |
| |
|
||||||||| |
|
|
| T |
44999154 |
gtgtgcctc |
44999146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 77 - 188
Target Start/End: Complemental strand, 44999520 - 44999409
Alignment:
| Q |
77 |
gtttggatcatatgtgtggaagacatataagcaagtttatgatgaagtcatgcatataggttcagctctacgtgcatctggtgctcaacatgtaagtgtt |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44999520 |
gtttggatcatatgtgtggaagacatataagcaagtttatgatgaagtcatgcatataggttcagctctacgtgcatctggtgctcaacatgtaagtgtt |
44999421 |
T |
|
| Q |
177 |
tgcaatgtaaaa |
188 |
Q |
| |
|
|||||||||||| |
|
|
| T |
44999420 |
tgcaatgtaaaa |
44999409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University