View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3953_low_11 (Length: 205)
Name: NF3953_low_11
Description: NF3953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3953_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 9e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 37 - 180
Target Start/End: Complemental strand, 54089527 - 54089384
Alignment:
| Q |
37 |
gatattgtaaatatgatgtgtgtgtacacacaaaagaaatgtaacaatatgtcctttaaaaaatatatgtaacaatacacacaccgatctttctttttgc |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54089527 |
gatattgtaaatatgatgtgtgtgtacacacaacagaaatgtaacaatatgtcctttaaaaaatatatgtaacaatacacacaccgatctttctttttgc |
54089428 |
T |
 |
| Q |
137 |
ccataaaagatacgtgaaaaaattgagtcttcccttttcaattg |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54089427 |
ttataaaagatacgtgaaaaaattgagtcttcccttttcaattg |
54089384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University