View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3955_high_1 (Length: 373)
Name: NF3955_high_1
Description: NF3955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3955_high_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 289; Significance: 1e-162; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 1 - 356
Target Start/End: Original strand, 8765861 - 8766214
Alignment:
| Q |
1 |
gtggtgtccggtgtttggtaccgtgtttgtaggtggttagggtgggagtgggttttacctaggaatcttcaagaattgcttcatatgggttagtgtcttt |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
8765861 |
gtggtgtccggtgtttggtatcgtgtttgtaagtggttagggtgggagtgggttttacctaggaatcttcaggaattgcttcat--gggttagtgtcttt |
8765958 |
T |
|
| Q |
101 |
acgtagtaggtgtagggatatactaagatttactatagtttggcattaaactgtgttatccatccggaaggcccgaaatgacattattttttctggtatt |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8765959 |
acgtagtaggcgtagggatatactaagatttactatattttggcattaaactgtgtggtccatccggaaggcccgaaatgacattattttttctggtatt |
8766058 |
T |
|
| Q |
201 |
gcccttgaggttgatattatggttgataagattcaattcccttgttggaattggttcattgctaaacacccttcacactattgttgattttatgagtgga |
300 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
8766059 |
gcccttgaggttgatattctggttgataagattcaattcctttattggaattggttcattgctaaacacccttcacactagtgttcattttatgagtgga |
8766158 |
T |
|
| Q |
301 |
aggtggagtcaattctttgttggcgccattattgttcagtttgttgggggcagagc |
356 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
8766159 |
aggtggagtcaattctttgttggcgccagtagtgttcagtttgttgggggcagagc |
8766214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 289 - 321
Target Start/End: Original strand, 9500222 - 9500254
Alignment:
| Q |
289 |
tttatgagtggaaggtggagtcaattctttgtt |
321 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
9500222 |
tttatgagtggaaggtggagccaattctttgtt |
9500254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University