View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3955_low_2 (Length: 350)
Name: NF3955_low_2
Description: NF3955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3955_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 2e-77; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 12 - 172
Target Start/End: Original strand, 223564 - 223721
Alignment:
| Q |
12 |
atgaatgggtgagggaaggatggctttcataaaatgtttagaatctttctccggcgccggtggccggacagagcttctccggcgagcctgcattgtttgt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
223564 |
atgaatgggtgagggaaggatggctttcataaaatgtttagaatctttctccggcgccggtggccggacagagcttctccggcgagcctgcattgtttgt |
223663 |
T |
 |
| Q |
112 |
tcacttgtgcaaataataataataaagtgaaatgagtttcaaaggttacttcacattctaa |
172 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
223664 |
tcacttgtgca---aataataataaagtgaaatgagtttcaaaggttacttcacattctaa |
223721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 12 - 104
Target Start/End: Original strand, 218356 - 218448
Alignment:
| Q |
12 |
atgaatgggtgagggaaggatggctttcataaaatgtttagaatctttctccggcgccggtggccggacagagcttctccggcgagcctgcat |
104 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| ||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
218356 |
atgaatggctgagggaaggatggctttcataaaatgtttagaatccttctccgccaccggtggccggacagagcttctccggcgagcctgcat |
218448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 31 - 107
Target Start/End: Original strand, 199215 - 199291
Alignment:
| Q |
31 |
atggctttcataaaatgtttagaatctttctccggcgccggtggccggacagagcttctccggcgagcctgcattgt |
107 |
Q |
| |
|
||||||||||||||||| || || |||||||||||||||||| |||| || | ||||||||| ||| ||||||||| |
|
|
| T |
199215 |
atggctttcataaaatgcttcgatgctttctccggcgccggtgaccggccacatcttctccggtgaggctgcattgt |
199291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 25 - 70
Target Start/End: Original strand, 212309 - 212354
Alignment:
| Q |
25 |
ggaaggatggctttcataaaatgtttagaatctttctccggcgccg |
70 |
Q |
| |
|
||||| ||||||||||||||||| || ||||||||||||| ||||| |
|
|
| T |
212309 |
ggaagtatggctttcataaaatgctttgaatctttctccgccgccg |
212354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 12 - 67
Target Start/End: Original strand, 29839309 - 29839364
Alignment:
| Q |
12 |
atgaatgggtgagggaaggatggctttcataaaatgtttagaatctttctccggcg |
67 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| || || |||||||||| |
|
|
| T |
29839309 |
atgaatgggtgagggaagtatggctttcataaaatgttttgattccttctccggcg |
29839364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 12 - 106
Target Start/End: Original strand, 3809336 - 3809431
Alignment:
| Q |
12 |
atgaatgggtgagggaaggatggctttcataaaatgtttagaat-ctttctccggcgccggtggccggacagagcttctccggcgagcctgcattg |
106 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||||| || | | |||||||||||| || | ||||||| ||||||||||||| |||||||| |
|
|
| T |
3809336 |
atgaatgggtgagggaattatggctttcagaaaatgttttgattaccttctccggcgccaatgactggacagaccttctccggcgaggctgcattg |
3809431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University