View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3955_low_2 (Length: 350)

Name: NF3955_low_2
Description: NF3955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3955_low_2
NF3955_low_2
[»] chr3 (4 HSPs)
chr3 (12-172)||(223564-223721)
chr3 (12-104)||(218356-218448)
chr3 (31-107)||(199215-199291)
chr3 (25-70)||(212309-212354)
[»] chr5 (1 HSPs)
chr5 (12-67)||(29839309-29839364)
[»] chr1 (1 HSPs)
chr1 (12-106)||(3809336-3809431)


Alignment Details
Target: chr3 (Bit Score: 147; Significance: 2e-77; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 12 - 172
Target Start/End: Original strand, 223564 - 223721
Alignment:
12 atgaatgggtgagggaaggatggctttcataaaatgtttagaatctttctccggcgccggtggccggacagagcttctccggcgagcctgcattgtttgt 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
223564 atgaatgggtgagggaaggatggctttcataaaatgtttagaatctttctccggcgccggtggccggacagagcttctccggcgagcctgcattgtttgt 223663  T
112 tcacttgtgcaaataataataataaagtgaaatgagtttcaaaggttacttcacattctaa 172  Q
    |||||||||||   |||||||||||||||||||||||||||||||||||||||||||||||    
223664 tcacttgtgca---aataataataaagtgaaatgagtttcaaaggttacttcacattctaa 223721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 12 - 104
Target Start/End: Original strand, 218356 - 218448
Alignment:
12 atgaatgggtgagggaaggatggctttcataaaatgtttagaatctttctccggcgccggtggccggacagagcttctccggcgagcctgcat 104  Q
    |||||||| |||||||||||||||||||||||||||||||||||| ||||||| | |||||||||||||||||||||||||||||||||||||    
218356 atgaatggctgagggaaggatggctttcataaaatgtttagaatccttctccgccaccggtggccggacagagcttctccggcgagcctgcat 218448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 31 - 107
Target Start/End: Original strand, 199215 - 199291
Alignment:
31 atggctttcataaaatgtttagaatctttctccggcgccggtggccggacagagcttctccggcgagcctgcattgt 107  Q
    ||||||||||||||||| || ||  |||||||||||||||||| |||| || | ||||||||| ||| |||||||||    
199215 atggctttcataaaatgcttcgatgctttctccggcgccggtgaccggccacatcttctccggtgaggctgcattgt 199291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 25 - 70
Target Start/End: Original strand, 212309 - 212354
Alignment:
25 ggaaggatggctttcataaaatgtttagaatctttctccggcgccg 70  Q
    ||||| ||||||||||||||||| || ||||||||||||| |||||    
212309 ggaagtatggctttcataaaatgctttgaatctttctccgccgccg 212354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 12 - 67
Target Start/End: Original strand, 29839309 - 29839364
Alignment:
12 atgaatgggtgagggaaggatggctttcataaaatgtttagaatctttctccggcg 67  Q
    |||||||||||||||||| |||||||||||||||||||| || || ||||||||||    
29839309 atgaatgggtgagggaagtatggctttcataaaatgttttgattccttctccggcg 29839364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 12 - 106
Target Start/End: Original strand, 3809336 - 3809431
Alignment:
12 atgaatgggtgagggaaggatggctttcataaaatgtttagaat-ctttctccggcgccggtggccggacagagcttctccggcgagcctgcattg 106  Q
    |||||||||||||||||  |||||||||| ||||||||| || | | ||||||||||||  || | ||||||| ||||||||||||| ||||||||    
3809336 atgaatgggtgagggaattatggctttcagaaaatgttttgattaccttctccggcgccaatgactggacagaccttctccggcgaggctgcattg 3809431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University