View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3955_low_6 (Length: 233)
Name: NF3955_low_6
Description: NF3955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3955_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 13 - 217
Target Start/End: Original strand, 36463532 - 36463736
Alignment:
| Q |
13 |
tcatcaaccgcctcggcgcccgccgaaccatcataaccgccaaccctctgaacgttgaatacattctcaaaaccaatttcactaacttccctaaaggaaa |
112 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| ||||| || ||||||||||| ||||||||||||||||| |||||||||||||| || |
|
|
| T |
36463532 |
tcatcaaccgcctcggcgcacgccgaaccatcataaccgccaatcctctcaatgttgaatacatcctcaaaaccaatttcaccaacttccctaaaggtaa |
36463631 |
T |
 |
| Q |
113 |
acccttcactgaaattctaagtgaccttttaggttgcggcatattcaatgcggatggaaagttgtggtcaaagcagcgtaaaataggcagccacgaattc |
212 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||| ||||||||||| |||||||| || ||||||||||| ||||| |||||| |
|
|
| T |
36463632 |
acccttcacagaaattctcagtgaccttttaggttgcggcatattcaatgtagatggaaagttatggtcaaaacaacgtaaaataggtagccatgaattc |
36463731 |
T |
 |
| Q |
213 |
acaac |
217 |
Q |
| |
|
||||| |
|
|
| T |
36463732 |
acaac |
36463736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University