View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3959_high_5 (Length: 314)
Name: NF3959_high_5
Description: NF3959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3959_high_5 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 18 - 314
Target Start/End: Complemental strand, 4757384 - 4757088
Alignment:
| Q |
18 |
acattgataaatacgtgtacatgtcttaccctctggagcggtgctgattcaacaataaattgacctttgatcctgattctatttaaggtacggtatattt |
117 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4757384 |
acattgacaaatacgtgtacatgtcttaccctctggagcggtgctggttcaacaataaattgacctttgatcctgattctatttaaggtacggtatattt |
4757285 |
T |
 |
| Q |
118 |
gccttagaaaccccacaatgacacgtataaaagtaattgattctcatcacataaatcaatgtcttgtcggtgttgaatactaaatgcatgtttgatatca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4757284 |
gccttagaaaccccacaatgacacgtataaaagtaattgattctcatcacataaatcaatgttttgtcggtgttgaatactaaatgcatgtttgatatca |
4757185 |
T |
 |
| Q |
218 |
taaaattatgactgagtcgatgtgattttgcaac-nnnnnnntggtggttcaccataattttgaagaatccacggcgataccaaacatgcaccgatta |
314 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||||||||||||||| ||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
4757184 |
taaaattatgac-gagtcgatgtgattttgcaacaaaaaaaatggtggttcaccataatttcgaagaatccacagcgataccaaacatgtaccgatta |
4757088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University