View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3959_low_12 (Length: 228)
Name: NF3959_low_12
Description: NF3959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3959_low_12 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 7 - 228
Target Start/End: Original strand, 32756162 - 32756383
Alignment:
| Q |
7 |
atgctcctcattctgaaagctcaaaagtttacgagagcatagatctctgtttgaagtttgaacttagggatagtttgaaaatggaagtttaaagtttgaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32756162 |
atgctcctcattctgaaagctcaaaagtttacgagagcatagatctctgtttgaagtttgaacttagggatagtttgaaaatggaagtttaaagtttgaa |
32756261 |
T |
|
| Q |
107 |
cttggttgagcaaacttagggcgtgcttgttttttgaaaataatttatgttttcttgtttaactgcaaatttgtcccctttttctgaaaccaaatagata |
206 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32756262 |
cttggttgagcaaacttagggtgtgcttgttttttgaaaataatttatgttttcttgtttaactgcaaaattgtcccctttttctgaaaccaaatagata |
32756361 |
T |
|
| Q |
207 |
tttgattgttaacttttgcatt |
228 |
Q |
| |
|
||||||||||||||| |||||| |
|
|
| T |
32756362 |
tttgattgttaacttctgcatt |
32756383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University