View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3959_low_7 (Length: 270)
Name: NF3959_low_7
Description: NF3959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3959_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 31245684 - 31245943
Alignment:
| Q |
1 |
ttagactttaccaatcaaacactcacaaaatatctgattaaaatcatgcttcaaaccatatttatcatgaattcacatgctaatgatcttgtgccgtatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31245684 |
ttagactttaccaatcaaacactcacaaaatatctgattaaaatcatgcttcaaaccatatttatcatgaattcacatgctaatgatcttgtgccgtatt |
31245783 |
T |
 |
| Q |
101 |
ttgcttgcttccaagagggaaacattttgagagcttacgaaggaaaaatcataaaa-ggatatatcaaacatgattgtgcatgaaaattcctctattgaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31245784 |
ttgcttgcttccaagagggaaacatttcgagagcttacgaaggaaaaatcataaaagggatatatcaaacatgattgtgcatgaaaattcctctattgaa |
31245883 |
T |
 |
| Q |
200 |
tattcaccccctactccggt----tacgtagacaaatgcttcgaccttaggttttgtttg |
255 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31245884 |
tattcaccccctactccggttacgtacgtagacaaatgcttcgaccttaggttttgtttg |
31245943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 108 - 172
Target Start/End: Original strand, 31220934 - 31220996
Alignment:
| Q |
108 |
cttccaagagggaaacattttgagagcttacgaaggaaaaatcataaaaggatatatcaaacatg |
172 |
Q |
| |
|
||||||| ||||||||| | |||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
31220934 |
cttccaatagggaaacaatctgagagcttacgaaggaaaagtcataaaag--tatatcaaacatg |
31220996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University