View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3960_high_14 (Length: 258)
Name: NF3960_high_14
Description: NF3960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3960_high_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 7 - 241
Target Start/End: Original strand, 8944588 - 8944822
Alignment:
| Q |
7 |
gacgaaattgataataagtagtaaaatataaggatgtaaacgaaacgtgataacatgaaagtttgacagaaatatagatatgagtaatgtttcaccgagt |
106 |
Q |
| |
|
||||||||||||| ||||| || |||||||||||||||| ||||||||| |||| ||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
8944588 |
gacgaaattgatactaagtggttaaatataaggatgtaagcgaaacgtgttaacgataaagtttgacagaaagatagatatgatcaatgtttcaccgagt |
8944687 |
T |
|
| Q |
107 |
aagaggcgtatttgaaatattcataatctcatggaccatttgaaagcgcaataaattacatggataaatttggtggtttcctttgattatatctaattga |
206 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| ||||||||||| |
|
|
| T |
8944688 |
aagagacgtatttaaaatattcataatctcatggaccatttgaaagcgcaataaattacatggatacatttggtggtttcctttcattgtatctaattga |
8944787 |
T |
|
| Q |
207 |
gtttatgtttttgaagatgcagaaatgaaaagtct |
241 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||| |
|
|
| T |
8944788 |
gtttatgtttttgacgatgcagaaatgaagagtct |
8944822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University