View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3960_low_10 (Length: 369)
Name: NF3960_low_10
Description: NF3960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3960_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 3e-98; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 3e-98
Query Start/End: Original strand, 153 - 349
Target Start/End: Original strand, 45386947 - 45387141
Alignment:
| Q |
153 |
gttatcattaaaaacctctcccatggcttcaagtttcacaaaaggaatctgcctctaagataagcttcgtgcaactatcacttatgccgtctttgccttc |
252 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45386947 |
gttatcattagaaacctctcccatggcttcaagtttcacaaaaggaatctgcctctaagataagcttcgtgcaactatcacttatgccgtctttgccttc |
45387046 |
T |
 |
| Q |
253 |
tctctcgcttttgtatactactgctaaagtacacctctatagtactactctatgatatgctaaatcctatacttataatctcatttttagtattata |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45387047 |
tctctcgcttttgtatactactgctaaagtacacctctatagtactactctatgatatgctaaatcctat--ttataatctcatttttagtattata |
45387141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 45386795 - 45386830
Alignment:
| Q |
1 |
tcttcctttttcggttcctctgttttctgttcttcc |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
45386795 |
tcttcctttttcggttcctctgttttctgttcttcc |
45386830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University