View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3960_low_18 (Length: 249)
Name: NF3960_low_18
Description: NF3960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3960_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 12 - 237
Target Start/End: Complemental strand, 44965100 - 44964874
Alignment:
| Q |
12 |
aaagggatatttcttgcaatctcttatcttttcgtgatttttctttgtgacccatgtctgtatagatgtggatttggcaacaatgaagctaaattaaaag |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44965100 |
aaagggatatttcttgcaatctcttatcttttcgtgatttttctttgtgacccatgtctgtatagatgtggatttggcaacaatgaagctaaattaaaag |
44965001 |
T |
 |
| Q |
112 |
tagcattgtttggagtatgggatagtgcaacatgaaag-aaaatatgttgtgttgtaatgtattgaatgtatcacatatgctatgttgttatccgcatgc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44965000 |
tagcattgtttggagtatgggatagtgcaacatgaaagaaaaatatgttgtgttgtaatgtattgaatgtatcacatatgctatgttgttatccgcatgc |
44964901 |
T |
 |
| Q |
211 |
aaaggatcaaattgatgtcctagaata |
237 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
44964900 |
aaaggatcaaattgatgtcctagaata |
44964874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University