View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3961_low_6 (Length: 322)
Name: NF3961_low_6
Description: NF3961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3961_low_6 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 1 - 322
Target Start/End: Complemental strand, 13087977 - 13087656
Alignment:
| Q |
1 |
acgatcaatgataacactgaggttatagggtgcaacatctttggcaagccactcatcaacatagaagatggtttgggaacaaggtttgtggggaccagtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13087977 |
acgatcaatgataacactgaggttatagggtgcaacatctttggcaagccactgatcaacatagaagatggtttgggaacaaggtttgtggggaccagtg |
13087878 |
T |
 |
| Q |
101 |
gaggtgacctccacgtagtcgcagtaccacccatggtggtacccagatccgtctgaggcgaggttgaggcggcaaacacgtgatttgatgcatggtccac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
13087877 |
gaggtgacctccacgtagtcgcagtaccacccatggtggtacccagatccgtctgaggcgaggttgaggcggcaaacacgtgagttgatgcatggtccac |
13087778 |
T |
 |
| Q |
201 |
gtccggtgaaggcatccacatttccgcgctcgaagtagttatgaccttctcccattgcaccccatgattttaggtttgggatccatactgattggttctt |
300 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13087777 |
gtccggtgaaggcatccacatttccacgctcgaagtagttatgaccttctcccattgcaccccatgattttaggtttgggatccacactgattggttctt |
13087678 |
T |
 |
| Q |
301 |
tgcatcgtcgaatctaatgctg |
322 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
13087677 |
tgcatcgtcgaatctaatgctg |
13087656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University