View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3962_high_18 (Length: 238)
Name: NF3962_high_18
Description: NF3962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3962_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 12 - 222
Target Start/End: Complemental strand, 443724 - 443514
Alignment:
| Q |
12 |
catcatcactgtctgaatcatcaatttctataatctgcttcttgttctcaagtagaaaagataaagcttctgtcttgatcctaagaaataaaaatacata |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
443724 |
catcatcactgtctgaatcatcaatttctataatctgcttcttgttctcaagtagaaaagataaagcttctgtcttgatcctaagaaataaaaatacata |
443625 |
T |
 |
| Q |
112 |
atcataattaggcttaaactacctaaggtaagattttaaaacatgcatgtaaccaaacaaagaaaacgaatgataccccatagcggtgcaaattgcattt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
443624 |
atcataattaggcttaaactacctaaggtaagattttaaaacatgcatgtaaccaaacaaagaaaacgaatgataccccatagcggtgcaaattgcattt |
443525 |
T |
 |
| Q |
212 |
gctgttttttc |
222 |
Q |
| |
|
||||||||||| |
|
|
| T |
443524 |
gctgttttttc |
443514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 194 - 222
Target Start/End: Original strand, 465379 - 465407
Alignment:
| Q |
194 |
gcggtgcaaattgcatttgctgttttttc |
222 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
465379 |
gcggtgcaaattgcatttgctgttttttc |
465407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University