View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3962_low_11 (Length: 422)
Name: NF3962_low_11
Description: NF3962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3962_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 19 - 269
Target Start/End: Complemental strand, 25405194 - 25404944
Alignment:
| Q |
19 |
atagttgaggggtacgtgtccttagaataattgtagttgaagggtcggtgaggattcacggtatcttaatctttacgacgaccttttttagttggaaaat |
118 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25405194 |
atagttgaagggtacgtgtccttagaataattgtagttgaagggtcggtgaggattcacggtatcttaatctttacgacgaccttttttagttggaaaat |
25405095 |
T |
 |
| Q |
119 |
attttccccataaaagtaattaaatgcattacttcaccacatggcaatactttaacggccagatcggatccataagttcccgtgaaagaagccacgtggg |
218 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25405094 |
attttgcccataaaagtaattaaatgcattacttcaccacatggcaatactttaacggccagatcggatccataagttcccgtgaaagaagccacgtggg |
25404995 |
T |
 |
| Q |
219 |
actcaaaaatccccttggctagggtttaaaggttaaatttaatcaacaaac |
269 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
25404994 |
actcaaaaatccccttagctagggttcaaaggttaaatttaatcaacaaac |
25404944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 303 - 404
Target Start/End: Complemental strand, 25404924 - 25404823
Alignment:
| Q |
303 |
ttttctccgtttgagctaatcatatcaagatgtatctaatactaaatataagtatttgtcgcacttagagttcaaactcggttcactatattataggagt |
402 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
25404924 |
ttttctctatttgagctaatcatatcaagatgtatcaaatactagatataagtatttgtcgcgtttagagtttaaactcggtgcactatattataggagt |
25404825 |
T |
 |
| Q |
403 |
at |
404 |
Q |
| |
|
|| |
|
|
| T |
25404824 |
at |
25404823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University