View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3962_low_17 (Length: 283)
Name: NF3962_low_17
Description: NF3962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3962_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 18 - 274
Target Start/End: Original strand, 47648665 - 47648920
Alignment:
| Q |
18 |
atcttcaagtaagcattatccatatgtaaatttggaaaacaatattgcctttctatggtgggggtgctcattgatttcaacaaactcaaagtattgtcta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47648665 |
atcttcaagtaagcattatccatatgtaaatttggaaaacaatattgcctttctgtggtgggggtgctcattgatttcaacaaactcaaagtattgtcta |
47648764 |
T |
|
| Q |
118 |
tgttatgaacggaactcaaagactcacagtgcttatggaggattggtgaaaaaatctcctcatgagatggttgcgttttgggcttttggctggaatccgc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47648765 |
tgttatgaacggaactcaaagactcacagtgcttatggaggattggtgaaaaaatctcctcatgagatggttgcgttttgggcttttggctggaatccgc |
47648864 |
T |
|
| Q |
218 |
gatggaggtggtggccaatggcagggatgtatctgccaccactcaacttagtataat |
274 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47648865 |
gatggaggtggtggccaatggca-ggatgtatctgccaccactcaacttagtataat |
47648920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University