View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3963_high_26 (Length: 341)
Name: NF3963_high_26
Description: NF3963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3963_high_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 277; Significance: 1e-155; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 16 - 300
Target Start/End: Complemental strand, 30885802 - 30885518
Alignment:
| Q |
16 |
atcaaacccctgcagtatcatcagaaacattgtacaaacaataacatgcaatagcacgcacctcccaaatttgtcggatttgcaataaatttcaaacaga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30885802 |
atcaaacccctgcagtatcatcagaaacattgtacaaacaataacatgcaatagcacgcacctcccaaatttgtcggatttgcaataaatttcaaacaga |
30885703 |
T |
|
| Q |
116 |
tcgtcttgagctgtggacaatggtgttgctcagccagggcaagtgttgtggctacggtctcagtattgatttcttcgcacaattttgattcacataacat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30885702 |
tcgtcttgagctgtggacaatggtgttgctcagccagggcaagtgtcgtggctacggtctcagtattgatttcttcacacaattttgattcacataacat |
30885603 |
T |
|
| Q |
216 |
ttttagcctgtcaagattatagagatcagcagcagccaatagatgctgcaccatgacagtaaaagagcacacatgtattgagccc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30885602 |
ttttagcctgtcaagattatagagatcagcagcagccaatagatgctgcaccatgacagtaaaagagcacacatgtattgagccc |
30885518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 299 - 330
Target Start/End: Complemental strand, 30885206 - 30885175
Alignment:
| Q |
299 |
ccgtttattttgatagagacaactcaccctat |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30885206 |
ccgtttattttgatagagacaactcaccctat |
30885175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University