View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3963_high_30 (Length: 320)
Name: NF3963_high_30
Description: NF3963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3963_high_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 69 - 300
Target Start/End: Complemental strand, 51065401 - 51065174
Alignment:
| Q |
69 |
cttctttattaatctcacaacacattatatcttcttcgtcggttccttgccgtgacattctatgtttcatcttcctgttctcttaagtttcctttttcag |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| || |
|
|
| T |
51065401 |
cttctttattaatctcacaacacattatatcttcttcgtcggttccttgccgtgacattctatgtttcatcttcctgttctctaaagtttcttttttgag |
51065302 |
T |
 |
| Q |
169 |
attcaaatcagataccctccctttgccaagattcacaattcatcaatcactgttctttcatatctaagatgaatttcactgcttcagagatctagtagtg |
268 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51065301 |
attcaaatcagataccct----ttgccaagattcacaattcatcaatcactgttctttcatatctaagatgaatttcaccgcttcagagatctagtagtg |
51065206 |
T |
 |
| Q |
269 |
ttttaaggattttggtttttcttaggtattca |
300 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |
|
|
| T |
51065205 |
ttttaaggattttggtttttgttaggtattca |
51065174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 3 - 39
Target Start/End: Complemental strand, 51065444 - 51065408
Alignment:
| Q |
3 |
gacagactgactgactaactcccccattccacatcac |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51065444 |
gacagactgactgactaactcccccattccacatcac |
51065408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University