View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3963_high_40 (Length: 284)
Name: NF3963_high_40
Description: NF3963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3963_high_40 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 45; Significance: 1e-16; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 31036966 - 31037022
Alignment:
| Q |
1 |
gttggattatgtgacattaaggattggtcaagtttcttaaagcttgtgtggtgcctt |
57 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
31036966 |
gttggattatttgacattaaggtttggtcaagtttcttaaagcttgtgtggtacctt |
31037022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 86 - 156
Target Start/End: Original strand, 31074219 - 31074289
Alignment:
| Q |
86 |
aacattagacaaccgaagtatttcgagcactagtattgaaattgaatcaagtttcttttgagcatacatca |
156 |
Q |
| |
|
||||||||| || |||| ||||| ||||| | ||||||||||| ||| |||||||||||||||| |||||| |
|
|
| T |
31074219 |
aacattagagaatcgaattattttgagcattggtattgaaattaaattaagtttcttttgagcacacatca |
31074289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 233 - 269
Target Start/End: Original strand, 31037093 - 31037129
Alignment:
| Q |
233 |
attcctttttgaacattctcactcagctctattttct |
269 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31037093 |
attcctttttgaacattctctctcagctctattttct |
31037129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University