View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3963_high_41 (Length: 275)
Name: NF3963_high_41
Description: NF3963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3963_high_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 253; Significance: 1e-141; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 261
Target Start/End: Complemental strand, 34115236 - 34114976
Alignment:
| Q |
1 |
ttaacttctacttgaaattttactcttagtttttccatatggaattggattttgaggactactttccatccatgatttcacgtttaggagcagaagggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34115236 |
ttaacttctacttgaaattttactcttagtttttccatatggaattggattttgaggactactttccatccatgatttcacgtttaggagcagaagggtt |
34115137 |
T |
 |
| Q |
101 |
tataggtgaactttgcaatggatttcgtttgcttatggatgtgaacaaaggtcttataacatttgagagcttgaagatgaattgtttcatgcttggcttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34115136 |
tataggtgaactttgcaatggatttcgtttgcttatggatgtgaacaaaggtcttataacatttgagagcttgaagatgaattgtttcatgcttggcttg |
34115037 |
T |
 |
| Q |
201 |
gaggtgagggatgaagaactcgggtacatgctaatggaaggtgatttggatggagatggtg |
261 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34115036 |
gaggtgagggatgaagaactcgtgtacatgctaatggagggtgatttggatggagatggtg |
34114976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 46 - 261
Target Start/End: Complemental strand, 34144285 - 34144070
Alignment:
| Q |
46 |
tggattttgaggactactttccatccatgatttcacgtttaggagcagaagggtttataggtgaactttgcaatggatttcgtttgcttatggatgtgaa |
145 |
Q |
| |
|
||||||||||||||||||||||||||||| || | |||||||||||||||| |||||||||||||||| ||| || |||| |||||||||||||| || |
|
|
| T |
34144285 |
tggattttgaggactactttccatccatggttgcgagtttaggagcagaaggttttataggtgaactttacaacgggtttcatttgcttatggatgccaa |
34144186 |
T |
 |
| Q |
146 |
caaaggtcttataacatttgagagcttgaagatgaattgtttcatgcttggcttggaggtgagggatgaagaactcgggtacatgctaatggaaggtgat |
245 |
Q |
| |
|
||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |||| |||||||||||||||||||||| |
|
|
| T |
34144185 |
caagggtcttataacatttgagagtttgaagatgaattgtttcatgcttggcttggaggtgagggacgaagagctcgtgtacatgctaatggaaggtgat |
34144086 |
T |
 |
| Q |
246 |
ttggatggagatggtg |
261 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
34144085 |
ttggatggagatggtg |
34144070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 45 - 261
Target Start/End: Complemental strand, 34176407 - 34176191
Alignment:
| Q |
45 |
ttggattttgaggactactttccatccatgatttcacgtttaggagcagaagggtttataggtgaactttgcaatggatttcgtttgcttatggatgtga |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||| || | ||||||||||||||| |||||||||||||||||| | || |||| ||||||||||||||| | |
|
|
| T |
34176407 |
ttggattttgaggactactttccatccatggttgcgagtttaggagcagaagcatttataggtgaactttgctacgggtttcatttgcttatggatgtca |
34176308 |
T |
 |
| Q |
145 |
acaaaggtcttataacatttgagagcttgaagatgaattgtttcatgcttggcttggaggtgagggatgaagaactcgggtacatgctaatggaaggtga |
244 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |||||| || |||| ||||||||||||||||||||| |
|
|
| T |
34176307 |
acaagggtcttataacatttgagagtttgaagatgaattgtttcatgcttggtatggaggtgaaggatgatgagctcgtgtacatgctaatggaaggtga |
34176208 |
T |
 |
| Q |
245 |
tttggatggagatggtg |
261 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
34176207 |
tttggatggagatggtg |
34176191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 228 - 261
Target Start/End: Original strand, 23630668 - 23630701
Alignment:
| Q |
228 |
atgctaatggaaggtgatttggatggagatggtg |
261 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
23630668 |
atgctaatggaaggtgattttgatggagatggtg |
23630701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University