View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3963_high_55 (Length: 237)

Name: NF3963_high_55
Description: NF3963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3963_high_55
NF3963_high_55
[»] chr3 (1 HSPs)
chr3 (24-221)||(54802220-54802421)


Alignment Details
Target: chr3 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 24 - 221
Target Start/End: Complemental strand, 54802421 - 54802220
Alignment:
24 tatagaaacaggtctttgttaattttgctcattagctaatacgcaatg-----acgcccttaaaattacttgggaattgtggtttgaagatggaagtcta 118  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||     ||||| | |||||||||||||||||||| ||||||||||||||||||    
54802421 tatagaaacaggtctttgttaattttgctcattagctaatatgcaatgcaatgacgccgt-aaaattacttgggaattgtgatttgaagatggaagtcta 54802323  T
119 tttttaagaggtcgtaagcaaaatgcctttgctttgtatgcataaataaatatcttgcaataaaataaaccagcaactttgtatgcaatccaaatgcaca 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54802322 tttttaagaggtcgtaagcaaaatgcctttgctttgtatgcataaataaatatcttgcaataaaataaaccagcaactttgtatgcaatccaaatgcaca 54802223  T
219 ttt 221  Q
    |||    
54802222 ttt 54802220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University