View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3963_high_59 (Length: 228)
Name: NF3963_high_59
Description: NF3963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3963_high_59 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 18 - 212
Target Start/End: Complemental strand, 5157682 - 5157480
Alignment:
| Q |
18 |
gtaagaaagaaagcagcatattgcagggaaatttcacttttgattaaatgaataataaatgcggtaggaactcttaatcaagaagcattggatatatccc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5157682 |
gtaagaaagaaagcagcatattgcagggaaatttcacttttgattaaatgaataataaatgcggtaggaactcttaatcaagaagcattggatctatccc |
5157583 |
T |
 |
| Q |
118 |
tagaacccgaatacacagccaatataatggt--------agcatcaattaagaagtcaaaaaagaagtggcatctcgaatcaccaaacctttagagttgg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5157582 |
tagaacccgaatacacagccaatataatggtagcaatgtagcatcaattaagaagtcaaaaaagaagtggcatcttgaatcaccaaacctttagagttgg |
5157483 |
T |
 |
| Q |
210 |
ttc |
212 |
Q |
| |
|
||| |
|
|
| T |
5157482 |
ttc |
5157480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University