View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3963_high_61 (Length: 221)
Name: NF3963_high_61
Description: NF3963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3963_high_61 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 17 - 203
Target Start/End: Original strand, 8993270 - 8993456
Alignment:
| Q |
17 |
taggtagattctgcatgtgaagattaagtgttactttgcgtagatgatgcagaagtaccactagtacgggacgagcaatttcattaaggattttgtcact |
116 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8993270 |
taggtagattgtggatgtgaagattaagtgttactttgtgtagatgatgcagaagtaccactagtacgggacgagcaatttcattaagggctttgtcact |
8993369 |
T |
|
| Q |
117 |
tcttaaatacgtgaggaaaataactagcagactaatggctaaaaactaaatcctttcgacatctttggcatgctttccacgtgtatg |
203 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8993370 |
tcttaaatacatgaggaaaataactagcagactaatggctaaaaactaaatcctttcgacatctttggcatcctttccacgtgtatg |
8993456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 132 - 200
Target Start/End: Complemental strand, 41635327 - 41635259
Alignment:
| Q |
132 |
gaaaataactagcagactaatggctaaaaactaaatcctttcgacatctttggcatgctttccacgtgt |
200 |
Q |
| |
|
||||||||||| || ||||| ||||||||||||||| |||||||| |||| || || ||||||||||| |
|
|
| T |
41635327 |
gaaaataactaacaaactaacagctaaaaactaaatcttttcgacaactttagcttgttttccacgtgt |
41635259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 153 - 199
Target Start/End: Complemental strand, 6470081 - 6470035
Alignment:
| Q |
153 |
ggctaaaaactaaatcctttcgacatctttggcatgctttccacgtg |
199 |
Q |
| |
|
|||||||||||||||| |||||||| ||||| | ||||||||||||| |
|
|
| T |
6470081 |
ggctaaaaactaaatcttttcgacaactttgacttgctttccacgtg |
6470035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 132 - 182
Target Start/End: Complemental strand, 21166101 - 21166051
Alignment:
| Q |
132 |
gaaaataactagcagactaatggctaaaaactaaatcctttcgacatcttt |
182 |
Q |
| |
|
||||||||||| |||||||| |||||||||||| ||| |||||||| |||| |
|
|
| T |
21166101 |
gaaaataactaacagactaacggctaaaaactacatcttttcgacagcttt |
21166051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 132 - 182
Target Start/End: Complemental strand, 21170722 - 21170672
Alignment:
| Q |
132 |
gaaaataactagcagactaatggctaaaaactaaatcctttcgacatcttt |
182 |
Q |
| |
|
||||||||||| |||||||| |||||||||||| ||| |||||||| |||| |
|
|
| T |
21170722 |
gaaaataactaacagactaacggctaaaaactacatcttttcgacaacttt |
21170672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University