View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3963_low_32 (Length: 309)
Name: NF3963_low_32
Description: NF3963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3963_low_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 16 - 267
Target Start/End: Original strand, 2161743 - 2161987
Alignment:
| Q |
16 |
atttgccgtgtaaaaaataaaagaaatactaactagattctaaatttcaaaagctagataccctaccaagctagatgtaattctagataccctatcaagc |
115 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2161743 |
atttcccgtgtaaaaaatagaagaaatactaactagattctaaatttcaaaagctagataccctaccaagctagatgtaattctagataccctatcaagc |
2161842 |
T |
 |
| Q |
116 |
tagaaggcaaaattatgacttgaaatcaagcactatgcttctaacagcgtaacctagcaataagatgcaaataactgctatcaatttctggattccatgc |
215 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
2161843 |
tagaa-------ttatgacttgaaatcaagcactatgcttctaacagcgtaacctagcaataagatgcaaatagctgttatcaatttctggattccatgc |
2161935 |
T |
 |
| Q |
216 |
gagaatctaatctcttccgaatagatcacttcccaatgcactatgaaaaccc |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2161936 |
gagaatctaatctcttccgaatagatcacttcccaatgcactatgaaaaccc |
2161987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 147 - 211
Target Start/End: Original strand, 2179566 - 2179630
Alignment:
| Q |
147 |
actatgcttctaacagcgtaacctagcaataagatgcaaataactgctatcaatttctggattcc |
211 |
Q |
| |
|
||||||| | ||||||| ||| ||||||||| || ||| |||||||||||||| |||||||||| |
|
|
| T |
2179566 |
actatgcctttaacagcataagctagcaataggaaccaagtaactgctatcaatatctggattcc |
2179630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University