View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3963_low_42 (Length: 273)
Name: NF3963_low_42
Description: NF3963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3963_low_42 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 3 - 174
Target Start/End: Complemental strand, 2161761 - 2161590
Alignment:
| Q |
3 |
tattttttacacggcaaatattattcacgtcttcttaatgcaagaagcatatgagtactcatattcttgcacaccttgtgcttgaatgtgtctatttcaa |
102 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2161761 |
tattttttacacgggaaatgttattcacgtcttcttaatgcaagaagcatatgagtactaatattcttgcacaccttgtgcttgaatgtgtctatttcaa |
2161662 |
T |
|
| Q |
103 |
taaaattgtttgttttatccatgcaacaaacaattttagtgttttggaattatgaggtgacattactttata |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2161661 |
taaaattgtttgttttatccatgcaacaaacaagtttagtgttttggaattatgaggtcacattactttata |
2161590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 235 - 273
Target Start/End: Complemental strand, 2161385 - 2161347
Alignment:
| Q |
235 |
ttttaatatatcaagccttaaatcgtttatgattgtgtt |
273 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2161385 |
ttttaatatatcaatccttaaatcgtttatgattgtgtt |
2161347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University