View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3963_low_52 (Length: 245)
Name: NF3963_low_52
Description: NF3963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3963_low_52 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 6684160 - 6683930
Alignment:
| Q |
1 |
tagctaagaccatattttttcccaatcatgatattgaaggatgggaccttttctcgaaaaaccttgtatcttggacatataggcattcttttggatcttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6684160 |
tagctaagaccatattttttcccaatcatgatattgaaggatgggaccttttctcgaaaaaccttgtatcttggacatataggcattcttttggatcttg |
6684061 |
T |
|
| Q |
101 |
taccttatagtaatagtacacttaacaccagctcaatcttttatgtaatgattgtgcttcttcacgttgttggcggacacagataaatatgtcatattta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6684060 |
taccttatagtaatagtacacttaacaccagctcaatcttttatgtaatgactgtgcttcttcaccttgttggcggacacagataaatatgtcatattta |
6683961 |
T |
|
| Q |
201 |
agatgggcttctaatttttagttttgctctg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6683960 |
agatgggcttctaatttttagttttgctctg |
6683930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University