View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3963_low_55 (Length: 237)
Name: NF3963_low_55
Description: NF3963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3963_low_55 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 24 - 221
Target Start/End: Complemental strand, 54802421 - 54802220
Alignment:
| Q |
24 |
tatagaaacaggtctttgttaattttgctcattagctaatacgcaatg-----acgcccttaaaattacttgggaattgtggtttgaagatggaagtcta |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||| ||||| | |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
54802421 |
tatagaaacaggtctttgttaattttgctcattagctaatatgcaatgcaatgacgccgt-aaaattacttgggaattgtgatttgaagatggaagtcta |
54802323 |
T |
 |
| Q |
119 |
tttttaagaggtcgtaagcaaaatgcctttgctttgtatgcataaataaatatcttgcaataaaataaaccagcaactttgtatgcaatccaaatgcaca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54802322 |
tttttaagaggtcgtaagcaaaatgcctttgctttgtatgcataaataaatatcttgcaataaaataaaccagcaactttgtatgcaatccaaatgcaca |
54802223 |
T |
 |
| Q |
219 |
ttt |
221 |
Q |
| |
|
||| |
|
|
| T |
54802222 |
ttt |
54802220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University