View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3963_low_58 (Length: 232)

Name: NF3963_low_58
Description: NF3963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3963_low_58
NF3963_low_58
[»] chr3 (1 HSPs)
chr3 (1-225)||(54808976-54809200)


Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 54809200 - 54808976
Alignment:
1 tgcaagggaggtgtttgatgatgttttggatagagatgtttttgtttggactgcgatgatttctggccttgcttgtcacgggatgtgtaaagaagctatt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
54809200 tgcaagggaggtgtttgatgatgttttggatagagatgtttttgtttggactgcgatgatttatggccttgcttgtcacgggatgtgtaaagaagctatt 54809101  T
101 gagttgtttcttgaaatggaaacttgtaatgtaaaacccgatgagaggacaattacggtggttttatcggcgtataggaatgcaggcttggttcgtgaag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
54809100 gagttgtttcttgaaatggaaacttgtaatgtaaaacccgatgagaggacaattatggtggttttatcggcgtataggaatgcaggcttggttcgtgaag 54809001  T
201 gttacatgtttttcgatgatgtcca 225  Q
    |||||||||||||| ||||||||||    
54809000 gttacatgtttttcaatgatgtcca 54808976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University