View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3963_low_64 (Length: 203)
Name: NF3963_low_64
Description: NF3963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3963_low_64 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 14 - 186
Target Start/End: Complemental strand, 15627701 - 15627529
Alignment:
| Q |
14 |
caaagggacattgccagattcaaatattcaagtagctgttaagagattttcacatgaatcaaaacaagggtttagggaattcgtgtctgaaatcgccagc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
15627701 |
caaagggacattgccagattcaaatattcaagtagctgttaagagattttcacatgaatcaaaacaagggcttagggaattcgtgtctgaaatcgccagc |
15627602 |
T |
 |
| Q |
114 |
ataggccggcttcgtcacaggaatttagttcagctacttggatggtgtcgccgcaaaggtgacctgctacttg |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
15627601 |
ataggccggcttcgtcacaggaatttagttcagctacttggatggtgtcgctgcaaaggcgacctgctacttg |
15627529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 80; Significance: 1e-37; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 39 - 178
Target Start/End: Complemental strand, 22921601 - 22921462
Alignment:
| Q |
39 |
attcaagtagctgttaagagattttcacatgaatcaaaacaagggtttagggaattcgtgtctgaaatcgccagcataggccggcttcgtcacaggaatt |
138 |
Q |
| |
|
|||||||| |||||||||||| |||||||||| |||||||||||| | |||||||| |||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
22921601 |
attcaagtggctgttaagagagtttcacatgagtcaaaacaagggctaagggaatttgtgtctgaaatcgctagcataggccggcttcgccacaggaatt |
22921502 |
T |
 |
| Q |
139 |
tagttcagctacttggatggtgtcgccgcaaaggtgacct |
178 |
Q |
| |
|
| ||| | |||| ||||||||||| |||| ||||||||| |
|
|
| T |
22921501 |
tggttatgttactcggatggtgtcgtcgcagaggtgacct |
22921462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 39 - 186
Target Start/End: Original strand, 22933990 - 22934137
Alignment:
| Q |
39 |
attcaagtagctgttaagagattttcacatgaatcaaaacaagggtttagggaattcgtgtctgaaatcgccagcataggccggcttcgtcacaggaatt |
138 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||||||||||| || ||||| || |||||||| || ||||||||||||||||| || |||||| |
|
|
| T |
22933990 |
attcaagtggctgttaagagagtttcacatgaatcaaaacaagggttgagagaatttgtatctgaaattgcaagcataggccggcttcgccatcggaatt |
22934089 |
T |
 |
| Q |
139 |
tagttcagctacttggatggtgtcgccgcaaaggtgacctgctacttg |
186 |
Q |
| |
|
| |||||| ||||||| ||||||||||||| ||| ||||| ||||||| |
|
|
| T |
22934090 |
tggttcagttacttgggtggtgtcgccgcagaggcgacctcctacttg |
22934137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 61 - 106
Target Start/End: Complemental strand, 22897668 - 22897623
Alignment:
| Q |
61 |
tttcacatgaatcaaaacaagggtttagggaattcgtgtctgaaat |
106 |
Q |
| |
|
||||||||||||||| ||||||| | |||||||||||||| ||||| |
|
|
| T |
22897668 |
tttcacatgaatcaagacaagggatgagggaattcgtgtcggaaat |
22897623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University