View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3964_high_1_N (Length: 355)
Name: NF3964_high_1_N
Description: NF3964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3964_high_1_N |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 5e-53; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 198 - 326
Target Start/End: Original strand, 52770471 - 52770602
Alignment:
| Q |
198 |
agtcagtgaattactaagttgctagtaaagtttccaatacttaaatagagagaatttttattgaaaataaattttctagttttgagctaagtt---ttct |
294 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52770471 |
agtcagtgaattacaaagttgctagtaaagtttccaatactaaaatagagagaattttgattgaaaataaattttctagttttgagctaagttttcttct |
52770570 |
T |
|
| Q |
295 |
atcttattcttgacatttactcagttttagta |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
52770571 |
atcttattcttgacatttactcagttttagta |
52770602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 30 - 146
Target Start/End: Complemental strand, 29465267 - 29465158
Alignment:
| Q |
30 |
catttgggattccttgtcttccatgtccccgtggccagcccttggaggtatgcttttccaatttccgttgatgaaaatggcatcctaactgttacagcta |
129 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
29465267 |
catttgggactccttgtcttccatgtccccgtggccagcccttggaggtatgcttttcca-------ttgatgaaaatggcatcctaactgttactgcta |
29465175 |
T |
|
| Q |
130 |
aggaaatatccactgac |
146 |
Q |
| |
|
|||||||||| |||||| |
|
|
| T |
29465174 |
aggaaatatctactgac |
29465158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 55; Significance: 1e-22; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 30 - 142
Target Start/End: Complemental strand, 8666834 - 8666729
Alignment:
| Q |
30 |
catttgggattccttgtcttccatgtccccgtggccagcccttggaggtatgcttttccaatttccgttgatgaaaatggcatcctaactgttacagcta |
129 |
Q |
| |
|
|||||||| ||| |||||||||| |||||||||||||||||||||||||||||||||| | ||||||||||||| ||||| |||||||| |||| |
|
|
| T |
8666834 |
catttgggcttcgttgtcttccaggtccccgtggccagcccttggaggtatgcttttcaa-------ttgatgaaaatggtatcctgactgttactgcta |
8666742 |
T |
|
| Q |
130 |
aggaaatatccac |
142 |
Q |
| |
|
|||||||||||| |
|
|
| T |
8666741 |
gggaaatatccac |
8666729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 54 - 139
Target Start/End: Original strand, 10495148 - 10495226
Alignment:
| Q |
54 |
gtccccgtggccagcccttggaggtatgcttttccaatttccgttgatgaaaatggcatcctaactgttacagctaaggaaatatc |
139 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
10495148 |
gtcctcgtggccagcccttggaggtatgcttttcca-------ttgatgaaaatggcatcctgactgttactgctaaggatatatc |
10495226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 48 - 139
Target Start/End: Original strand, 13334136 - 13334220
Alignment:
| Q |
48 |
ttccatgtccccgtggccagcccttggaggtatgcttttccaatttccgttgatgaaaatggcatcctaactgttacagctaaggaaatatc |
139 |
Q |
| |
|
||||| |||| ||||| ||||||||||||||||||||||||| ||||||||||||||||||| || ||||| |||||||| ||||| |
|
|
| T |
13334136 |
ttccaggtccgcgtggtcagcccttggaggtatgcttttcca-------ttgatgaaaatggcatcctgacggttactgctaaggatatatc |
13334220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 42 - 89
Target Start/End: Complemental strand, 8653850 - 8653803
Alignment:
| Q |
42 |
cttgtcttccatgtccccgtggccagcccttggaggtatgcttttcca |
89 |
Q |
| |
|
|||| |||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8653850 |
cttgccttccaggtccccgtggtcagcccttggaggtatgcttttcca |
8653803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 30 - 139
Target Start/End: Original strand, 9336644 - 9336746
Alignment:
| Q |
30 |
catttgggattccttgtcttccatgtccccgtggccagcccttggaggtatgcttttccaatttccgttgatgaaaatggcatcctaactgttacagcta |
129 |
Q |
| |
|
||||| || ||| |||||||||| |||||||||||| |||||||||| |||||||| | |||||||||||||||||||||||||||| |||| |
|
|
| T |
9336644 |
catttcggcttcattgtcttccagctccccgtggccatcccttggaggcctgcttttcga-------ttgatgaaaatggcatcctaactgttactgcta |
9336736 |
T |
|
| Q |
130 |
aggaaatatc |
139 |
Q |
| |
|
||||||||| |
|
|
| T |
9336737 |
gggaaatatc |
9336746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University