View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3965_high_14 (Length: 243)
Name: NF3965_high_14
Description: NF3965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3965_high_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 120
Target Start/End: Original strand, 2138125 - 2138250
Alignment:
| Q |
1 |
caactcaacgtgtcggaaaatcccatgatgttccaaaacaacaacaaca------acatgcgaagtgttgttatggcttcaccagtttcaccattggaat |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2138125 |
caactcaacgtgtcggaaaatcccatgatgttccaaaacaacaacaacaataacaacatgcgaagtgttgttatggcttcaccagtttcaccattggaat |
2138224 |
T |
|
| Q |
95 |
attactatagcccaaaatcaccacat |
120 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
2138225 |
attactatagcccaaaatcaccacat |
2138250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 164 - 235
Target Start/End: Original strand, 2138294 - 2138365
Alignment:
| Q |
164 |
gtttctatttgcacccctctcctagagcttctcagcaacaaccacctgcacttttacctctttttcctttgc |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2138294 |
gtttctatttgcacccctctcctagagcttctcagcaacaaccacctgcacttttacctctttttcctttgc |
2138365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University