View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3965_high_16 (Length: 240)

Name: NF3965_high_16
Description: NF3965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3965_high_16
NF3965_high_16
[»] chr8 (2 HSPs)
chr8 (1-95)||(25839943-25840037)
chr8 (161-224)||(25840102-25840165)


Alignment Details
Target: chr8 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 1 - 95
Target Start/End: Original strand, 25839943 - 25840037
Alignment:
1 tgatcaagaggaggcacttaagtcgtgttgtcatgtgtttgtttaagaggtgttactattagacactgagttgcttcttcgtgtggttcatctta 95  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
25839943 tgatcaagaggaggcacttaagtcgtgctgtcatgtgtttgtttaagaggtgttactattagacactgagttgcttcttcgtgtggttcacctta 25840037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 161 - 224
Target Start/End: Original strand, 25840102 - 25840165
Alignment:
161 gcgcaggccattttgagatattgttgggaagctttgtttaactcagccaaatcccttgagatct 224  Q
    |||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
25840102 gcgcaggctattttgagatattgttgggaagctttgtctaactcagccaaatcccttgagatct 25840165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University