View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3965_low_13 (Length: 255)
Name: NF3965_low_13
Description: NF3965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3965_low_13 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 19 - 255
Target Start/End: Complemental strand, 2447247 - 2447009
Alignment:
| Q |
19 |
cttgccacattttattggtttttattaagtaaagtttattgccgagtagaaacgaaaatttatgtggagacaatttttacatatcatttt--attacttg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |||||| ||||||||| |||||||| |
|
|
| T |
2447247 |
cttgccacattttattggtttttattaagtaaagtttattgtcgagtagaaatgaaaatttatgtggagacaaattttacttatcattttttattacttg |
2447148 |
T |
 |
| Q |
117 |
tgtgatttaatacacttgctatattgtctatttgagcacttttttgctttccaaatctacgactgagacatattttctatagattaataaggattcctaa |
216 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2447147 |
tgtgatttaatacacttgctatattatctatttgagcacttttttgctttcgaaatctacgactgagacatattttctatagattaataaggattcctaa |
2447048 |
T |
 |
| Q |
217 |
taacatatggcatgaaattcttaccctttttcaaatgtt |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2447047 |
taacatatggcatgaaattcttaccctttttcaaatgtt |
2447009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University