View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3965_low_17 (Length: 240)
Name: NF3965_low_17
Description: NF3965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3965_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 1 - 95
Target Start/End: Original strand, 25839943 - 25840037
Alignment:
| Q |
1 |
tgatcaagaggaggcacttaagtcgtgttgtcatgtgtttgtttaagaggtgttactattagacactgagttgcttcttcgtgtggttcatctta |
95 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25839943 |
tgatcaagaggaggcacttaagtcgtgctgtcatgtgtttgtttaagaggtgttactattagacactgagttgcttcttcgtgtggttcacctta |
25840037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 161 - 224
Target Start/End: Original strand, 25840102 - 25840165
Alignment:
| Q |
161 |
gcgcaggccattttgagatattgttgggaagctttgtttaactcagccaaatcccttgagatct |
224 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
25840102 |
gcgcaggctattttgagatattgttgggaagctttgtctaactcagccaaatcccttgagatct |
25840165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University