View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3965_low_20 (Length: 235)
Name: NF3965_low_20
Description: NF3965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3965_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 16 - 226
Target Start/End: Original strand, 41220677 - 41220890
Alignment:
| Q |
16 |
aagataaaacaattgcaagaactaaaattagatttaactcatattacaagaattcgaagcacggttaacccaaaaatctcaacctttgagccac--ctct |
113 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| ||| ||| |||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
41220677 |
aagataaaacaattgcaagaactaaaactagatttaactcatgttataaggattcgaagcacgattaacccaaaaatctcaacctttgagccacctctct |
41220776 |
T |
 |
| Q |
114 |
caattttctctcttccttctttgtcatccaattgaggtcggggtggtgtttgcctggaatggattgttttt-ccccctccttaactaaataggtgagctt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
41220777 |
caattttctctcttccttctttgtcatccaattgaggtcggggtgttgtttgcctggaatagattgtttttcccccctccttaactaaataggtgggctt |
41220876 |
T |
 |
| Q |
213 |
cacatggtgatgat |
226 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
41220877 |
cacatggttatgat |
41220890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University