View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3965_low_25 (Length: 210)
Name: NF3965_low_25
Description: NF3965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3965_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 7e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 15 - 125
Target Start/End: Complemental strand, 20816747 - 20816638
Alignment:
| Q |
15 |
agagactaatggcatggatgaaagaaaattgagcgaccaaaagcctcataaatatgttaagaggactaaaaccaaaagattgtatatttagatgaaccat |
114 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
20816747 |
agagactaattgcatggatgaaa-aaaattgagcgaccaaaagcctcataaatatgttaaggggactaaaactaaaagattgtatttttagatgaaccat |
20816649 |
T |
|
| Q |
115 |
ttacttattta |
125 |
Q |
| |
|
||||||||||| |
|
|
| T |
20816648 |
ttacttattta |
20816638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 121
Target Start/End: Original strand, 17431136 - 17431208
Alignment:
| Q |
49 |
gaccaaaagcctcataaatatgttaagaggactaaaaccaaaagattgtatatttagatgaaccatttactta |
121 |
Q |
| |
|
|||||||||||| | |||||| ||| | ||||||||| |||| | | |||||||||||| |||||||||||| |
|
|
| T |
17431136 |
gaccaaaagcctaaaaaatattttagggggactaaaatcaaatgttgatatatttagatggaccatttactta |
17431208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 97 - 125
Target Start/End: Complemental strand, 3935997 - 3935969
Alignment:
| Q |
97 |
tatatttagatgaaccatttacttattta |
125 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3935997 |
tatatttagatgaaccatttacttattta |
3935969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University