View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3966_high_3 (Length: 367)

Name: NF3966_high_3
Description: NF3966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3966_high_3
NF3966_high_3
[»] chr1 (2 HSPs)
chr1 (147-355)||(49511065-49511273)
chr1 (1-110)||(49510922-49511031)
[»] chr4 (1 HSPs)
chr4 (156-216)||(47488195-47488255)
[»] chr2 (1 HSPs)
chr2 (153-218)||(45230420-45230485)


Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 147 - 355
Target Start/End: Original strand, 49511065 - 49511273
Alignment:
147 gatcaaaaggttttggggattgatgaacagtttgctcaaatggttgttggtgttggtggtattggacagaggctacaggatgagggttttgctgtcatgt 246  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49511065 gatcaaaaggttttggggattgatgaacagtttgctcaaatggttgttggtgttggtggtattggacagaggctacaggatgagggttttgctgtcatgt 49511164  T
247 cttcaccacctcatcctcctgtgccaactacgctggcggcggttggtgttccgattggttctgctgtggttgttggtgattaccagaatagggtattctc 346  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49511165 cttcaccacctcatcctcctgtgccaactacgctggcggcggttggtgttccgattggttctgctgtggttgttggtgattaccagaatagggtattctc 49511264  T
347 tgatgatga 355  Q
    |||||||||    
49511265 tgatgatga 49511273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 106; E-Value: 6e-53
Query Start/End: Original strand, 1 - 110
Target Start/End: Original strand, 49510922 - 49511031
Alignment:
1 tgatggagacttcttcgtcctttggttcgacttcttcgtctccgtctttagcgaatttgcctcctatcagggtgcatgttgaagatggtgtttccggtgg 100  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49510922 tgatggagacttcttcgtcctttggctcgacttcttcgtctccgtctttagcgaatttgcctcctatcagggtgcatgttgaagatggtgtttccggtgg 49511021  T
101 tgttagggct 110  Q
    ||||||||||    
49511022 tgttagggct 49511031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 57; Significance: 1e-23; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 156 - 216
Target Start/End: Complemental strand, 47488255 - 47488195
Alignment:
156 gttttggggattgatgaacagtttgctcaaatggttgttggtgttggtggtattggacaga 216  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47488255 gttttgaggattgatgaacagtttgctcaaatggttgttggtgttggtggtattggacaga 47488195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 54; Significance: 6e-22; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 153 - 218
Target Start/End: Complemental strand, 45230485 - 45230420
Alignment:
153 aaggttttggggattgatgaacagtttgctcaaatggttgttggtgttggtggtattggacagagg 218  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| |||||||    
45230485 aaggttttgaggattgatgaacagtttgctcaaatggttgttggtgttagtggtattgaacagagg 45230420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University