View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3966_high_5 (Length: 311)
Name: NF3966_high_5
Description: NF3966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3966_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 1 - 293
Target Start/End: Original strand, 50073774 - 50074066
Alignment:
| Q |
1 |
aacatactcgctttctgaagtgataacacccatgataannnnnnnactcttaagaaagttaattaagatcaatgttctctttcttttggtgtggattgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50073774 |
aacatactcgctttctgaagtgataacacccatgataattttttgactcttaagaaagttaattaagatcaatgttctctttcttttggtgtggattgat |
50073873 |
T |
 |
| Q |
101 |
atgttggcatatgcgttaatttataggcgctgcaatgcagcaataggtcactgtggagttacccctagaacacgaaagtttataagtaagttttaatttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50073874 |
atgttggcatatgcgttaatttataggcgctgcaatggagcaataggtcactgtggagttgcccctagaacacgaaagtttataagtaagttttaatttt |
50073973 |
T |
 |
| Q |
201 |
caatttcatgtttgccaatctgtaataattaatgtggggaaatgcttgcattatcgtatagcaattcctcaaggtcttattttaggctagtat |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50073974 |
caatttcatgtttgccaatctgtaataattaatgtggggaaatgcttgcattatcgtatagcaattcctcaaggtcttattttaggctagtat |
50074066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University