View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3966_high_9 (Length: 227)
Name: NF3966_high_9
Description: NF3966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3966_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 86 - 208
Target Start/End: Complemental strand, 27196243 - 27196121
Alignment:
| Q |
86 |
gttcttcgttatcggaatcgcgatgatgattacgctttcggcgtgtgtaaacgaagtaaccgtttatctgaatcttacttttgcatgtgtcggtttccat |
185 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27196243 |
gttcttcgttatcgaaatcgcggtgatgattacgctttctgcgtgtgtaaacgaagtaaccgtttatctgaatcttactcttgcatgtgtcggtttccat |
27196144 |
T |
|
| Q |
186 |
gggggaggttaatatgaagaaga |
208 |
Q |
| |
|
||||||||| ||| ||||||||| |
|
|
| T |
27196143 |
gggggaggtgaatctgaagaaga |
27196121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 20 - 92
Target Start/End: Complemental strand, 27196361 - 27196281
Alignment:
| Q |
20 |
acatcttcacatgaataaacttgcaccttaaacgacggccgccact--------gaagtccatttaacgacgtcgttcttc |
92 |
Q |
| |
|
|||||||||| ||||| ||||| |||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
27196361 |
acatcttcacctgaatcaactttcaccttaaacgacggccgccgttgccgtttcgaagtccatttaacgacgtcgttcttc |
27196281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 86 - 208
Target Start/End: Original strand, 43712503 - 43712625
Alignment:
| Q |
86 |
gttcttcgttatcggaatcgcgatgatgattacgctttcggcgtgtgtaaacgaagtaaccgtttatctgaatcttacttttgcatgtgtcggtttccat |
185 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| ||| |
|
|
| T |
43712503 |
gttcttcgttatgggaatcgcgatgatgattatgctttcggcgtgtgtaaacgaagtaaccgtttatctgaatcttactcttgaatgtgtcggtttacat |
43712602 |
T |
|
| Q |
186 |
gggggaggttaatatgaagaaga |
208 |
Q |
| |
|
|| |||||||||| ||||||||| |
|
|
| T |
43712603 |
ggaggaggttaatctgaagaaga |
43712625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 86 - 208
Target Start/End: Complemental strand, 26272358 - 26272236
Alignment:
| Q |
86 |
gttcttcgttatcggaatcgcgatgatgattacgctttcggcgtgtgtaaacgaagtaaccgtttatctgaatcttacttttgcatgtgtcggtttccat |
185 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| | ||| ||||||| |||| ||| |
|
|
| T |
26272358 |
gttcttcgttctcgaaatcgcgatgatgattatgctttcggcgtgtgtaaacgaagtaaccatttatctgaatcttattcttgaatgtgtcagtttacat |
26272259 |
T |
|
| Q |
186 |
gggggaggttaatatgaagaaga |
208 |
Q |
| |
|
|| |||||||||| ||||||||| |
|
|
| T |
26272258 |
ggaggaggttaatctgaagaaga |
26272236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University