View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3966_low_3 (Length: 367)
Name: NF3966_low_3
Description: NF3966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3966_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 147 - 355
Target Start/End: Original strand, 49511065 - 49511273
Alignment:
| Q |
147 |
gatcaaaaggttttggggattgatgaacagtttgctcaaatggttgttggtgttggtggtattggacagaggctacaggatgagggttttgctgtcatgt |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49511065 |
gatcaaaaggttttggggattgatgaacagtttgctcaaatggttgttggtgttggtggtattggacagaggctacaggatgagggttttgctgtcatgt |
49511164 |
T |
 |
| Q |
247 |
cttcaccacctcatcctcctgtgccaactacgctggcggcggttggtgttccgattggttctgctgtggttgttggtgattaccagaatagggtattctc |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49511165 |
cttcaccacctcatcctcctgtgccaactacgctggcggcggttggtgttccgattggttctgctgtggttgttggtgattaccagaatagggtattctc |
49511264 |
T |
 |
| Q |
347 |
tgatgatga |
355 |
Q |
| |
|
||||||||| |
|
|
| T |
49511265 |
tgatgatga |
49511273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 106; E-Value: 6e-53
Query Start/End: Original strand, 1 - 110
Target Start/End: Original strand, 49510922 - 49511031
Alignment:
| Q |
1 |
tgatggagacttcttcgtcctttggttcgacttcttcgtctccgtctttagcgaatttgcctcctatcagggtgcatgttgaagatggtgtttccggtgg |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49510922 |
tgatggagacttcttcgtcctttggctcgacttcttcgtctccgtctttagcgaatttgcctcctatcagggtgcatgttgaagatggtgtttccggtgg |
49511021 |
T |
 |
| Q |
101 |
tgttagggct |
110 |
Q |
| |
|
|||||||||| |
|
|
| T |
49511022 |
tgttagggct |
49511031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 57; Significance: 1e-23; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 156 - 216
Target Start/End: Complemental strand, 47488255 - 47488195
Alignment:
| Q |
156 |
gttttggggattgatgaacagtttgctcaaatggttgttggtgttggtggtattggacaga |
216 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47488255 |
gttttgaggattgatgaacagtttgctcaaatggttgttggtgttggtggtattggacaga |
47488195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 54; Significance: 6e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 153 - 218
Target Start/End: Complemental strand, 45230485 - 45230420
Alignment:
| Q |
153 |
aaggttttggggattgatgaacagtttgctcaaatggttgttggtgttggtggtattggacagagg |
218 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
45230485 |
aaggttttgaggattgatgaacagtttgctcaaatggttgttggtgttagtggtattgaacagagg |
45230420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University