View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3968_high_13 (Length: 322)
Name: NF3968_high_13
Description: NF3968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3968_high_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 238 - 305
Target Start/End: Original strand, 434635 - 434702
Alignment:
| Q |
238 |
cataaccatgcattggtccgtttcaaacggaaagtcaataagaaacgttatttttgctattcctaact |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
434635 |
cataaccatgcattggtccgtttcaaacggaaagtcaataagaaacgttatttttgctattcctaact |
434702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 92 - 152
Target Start/End: Original strand, 434491 - 434550
Alignment:
| Q |
92 |
gtatggtttagactaattcaaataaaaacttaatacaatgcatattgttacggcacccaaa |
152 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
434491 |
gtatggtttagactaattcaaataaaa-cttaatacaatgcatattgttacggcacccaaa |
434550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University