View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3968_high_13 (Length: 322)

Name: NF3968_high_13
Description: NF3968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3968_high_13
NF3968_high_13
[»] chr7 (2 HSPs)
chr7 (238-305)||(434635-434702)
chr7 (92-152)||(434491-434550)


Alignment Details
Target: chr7 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 238 - 305
Target Start/End: Original strand, 434635 - 434702
Alignment:
238 cataaccatgcattggtccgtttcaaacggaaagtcaataagaaacgttatttttgctattcctaact 305  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
434635 cataaccatgcattggtccgtttcaaacggaaagtcaataagaaacgttatttttgctattcctaact 434702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 92 - 152
Target Start/End: Original strand, 434491 - 434550
Alignment:
92 gtatggtttagactaattcaaataaaaacttaatacaatgcatattgttacggcacccaaa 152  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
434491 gtatggtttagactaattcaaataaaa-cttaatacaatgcatattgttacggcacccaaa 434550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University