View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3968_high_14 (Length: 313)
Name: NF3968_high_14
Description: NF3968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3968_high_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 17 - 227
Target Start/End: Original strand, 3331325 - 3331527
Alignment:
| Q |
17 |
aataataaagtatagaattttgaggaaatcatttgatggggggattgggtgcactgcaccctcagttttagaggat----catgatagtgatattacaaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3331325 |
aataataaagtatagaattttgaggaaatcatttgatggggggattgggtgcactgcaccctcagttttagaggatcatgcatgatagtgatattacaaa |
3331424 |
T |
|
| Q |
113 |
taacataccataaacaaatttgcatccgatgttttctcagctattttctcccttcattgtcttattattttaagtttcatttcacacctttgaatatgtg |
212 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3331425 |
taacataccataaacaaatttgcatctgatg------------ttttctccctttattgtcttattattataagtttcatttcacacctttgaatatgtg |
3331512 |
T |
|
| Q |
213 |
tcccactaaaatgga |
227 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
3331513 |
tcccactaaaatgga |
3331527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 226 - 302
Target Start/End: Original strand, 3331558 - 3331634
Alignment:
| Q |
226 |
gatacaagtttaaaatgttttggaccgttgcatcttgtatcgaagaactagagcctatatataacctttgtctctct |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3331558 |
gatacaagtttaaaatgttttggaccgttgcatcttgtatcgaagaactagagcctatatataacctttgtctctct |
3331634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University