View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3968_high_28 (Length: 204)
Name: NF3968_high_28
Description: NF3968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3968_high_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 28267638 - 28267513
Alignment:
| Q |
1 |
cagtgtgtgtgtcagtctgacaggaaaaataaatgtttattgtgtctctttggattgaggaatacgtgcataaacatcataatttatgattactttgaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
28267638 |
cagtgtgtgtgtcagtctgacaggaaaaataaatgtttattgtgtctctttggattgaggaatacatgcataaacatcataatttatgattgctttgaaa |
28267539 |
T |
|
| Q |
101 |
tctatgtccatttaatatttcaaagg |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
28267538 |
tctatgtccatttaatatttcaaagg |
28267513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University