View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3968_low_22 (Length: 237)

Name: NF3968_low_22
Description: NF3968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3968_low_22
NF3968_low_22
[»] chr1 (2 HSPs)
chr1 (66-229)||(10379500-10379663)
chr1 (1-31)||(10379691-10379721)


Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 66 - 229
Target Start/End: Complemental strand, 10379663 - 10379500
Alignment:
66 gcaacaatttaacactaggtcagaggctcgctgagggcaatgcgagcgatgcaaattcaaaaaacactatcctattaaatataacggaaaaatgcaatat 165  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
10379663 gcaacaatttaacactagttcagaggctcgctgagggcaatgcgagcgatgcaaattcaaaaaacactatcctaataaatataacggaaaaatgcaatat 10379564  T
166 atttataaataagccatattatatctagttaaatcaatattgtattattaacatagtgatgatg 229  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
10379563 atttataaataagccatattatatctagttaaatcaatattgtactattaacatagtgatgatg 10379500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Complemental strand, 10379721 - 10379691
Alignment:
1 aactggcttctccaccctgactctcagttgg 31  Q
    |||||||||||||||||||||||||||||||    
10379721 aactggcttctccaccctgactctcagttgg 10379691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University