View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3969_low_12 (Length: 287)
Name: NF3969_low_12
Description: NF3969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3969_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 272
Target Start/End: Complemental strand, 9488753 - 9488482
Alignment:
| Q |
1 |
gactcaaaccaggtttgtgctttcttttgtttctgctatcatctaagtaacgtcaggtttcaccatctatgttaattgcttcattgtcaccgatctttct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9488753 |
gactcaaaccaggtttgtgctttcttttgtttctgctatcatctaagtaacgtcaggtttcaccatcgatgttaattgcttcattgtcaccgatctttct |
9488654 |
T |
 |
| Q |
101 |
ttcccttccgtatccaaacttgagcatgacaattttgatgacaatggtggattgtccggtgctcgtgattatctgtttatattttggcctgcagcatttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9488653 |
ttcccttccgtatccaaacttgagcatgacaattttgatgacgatagtgggttgtccggtgctcgtgattatctgtttatattttggcctgcagcatttt |
9488554 |
T |
 |
| Q |
201 |
aatgtctcttttttctcttcgtctttccctttctgttcgcgcatttgcaggattcatccacaactgttcgat |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9488553 |
aatgtctcttttttctcttcgtctttccctttctgttcgcgcatttgcaggattcttccacaactgttcgat |
9488482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University