View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3969_low_17 (Length: 250)
Name: NF3969_low_17
Description: NF3969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3969_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 24489281 - 24489047
Alignment:
| Q |
1 |
cagtttgcaagttgccaatgatgcccatgtaagttctatataactttacatcgtgctcgtcataatttattttaagacaagtccaagagaaatcccagct |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| |
|
|
| T |
24489281 |
cagtttgcaagttgccaatgatgccgatgtaagttctatataactttacatcgtgctcgtcataatttatttgaagacaagtccaagagaaatccccgct |
24489182 |
T |
 |
| Q |
101 |
ggttaatttcaagttcaacctcttggaggaagatggcacgggaactttggttaatttcaacctcttgaagtaagtatccaacgtttcgagtatggggcag |
200 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24489181 |
ggttaatttcaagttcaacctcttgaaggaagatggcacaggaactttggttaatttcaacctcttgacgtaagtatccaacgtttcgagtatggggcag |
24489082 |
T |
 |
| Q |
201 |
ccagcagcgaggaagacagccattgattccacaatatt |
238 |
Q |
| |
|
| |||||||||||||| ||||||| ||||||||||| |
|
|
| T |
24489081 |
c---cagcgaggaagacaaccattgaatccacaatatt |
24489047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 114 - 151
Target Start/End: Complemental strand, 17772413 - 17772376
Alignment:
| Q |
114 |
ttcaacctcttggaggaagatggcacgggaactttggt |
151 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17772413 |
ttcaacctcttggaggaaggtggcacgggaactttggt |
17772376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University