View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3969_low_23 (Length: 204)
Name: NF3969_low_23
Description: NF3969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3969_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 11 - 186
Target Start/End: Original strand, 47818415 - 47818588
Alignment:
| Q |
11 |
cagcacagacaagacaatgatctccagatgcaagtaattgtccttttcttggttcattattatttttctcaaaatatttaaaagacgaaaagttatatgt |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47818415 |
cagcccagacaagacaatgatctccagatgcaagtaattgtccttttcttggttcatta---tttttctcaaaatatttaaaagacgaaaagttatatgt |
47818511 |
T |
|
| Q |
111 |
tccctatttttgttttcaaggaagcc-ttatttttatatttaaaagatgcctctaaattttcataggcataggctca |
186 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47818512 |
tccctatttttgttttcaaggaagcctttatttttatatttaaaagatgcctctaaattttcataggcataggctca |
47818588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University