View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3970_low_8 (Length: 318)
Name: NF3970_low_8
Description: NF3970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3970_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 20 - 215
Target Start/End: Complemental strand, 16700210 - 16700015
Alignment:
| Q |
20 |
tcggttgcagttacgtgtcaaccgttattgtggtaaaatgtagatgacacgtttgaaattgtggttgtcgaaatgttgtagatacttaaaaatcttttat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
16700210 |
tcggttgcagttacgtgtcaaccgttattgtggtaaaatgtagatgacacatttgaaattgtggttgtcgaaatgttgtagatacttaaaaatgttttat |
16700111 |
T |
 |
| Q |
120 |
attatggcggttgtggaccgcaatttaaaaccatgatcatagtatactgatagtcgtgtctttgatgtcgcaaccacaatctcaccattcattttt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| ||| ||||||||| |
|
|
| T |
16700110 |
attatggcggttgtggaccgcaatttaaaaccatgatcatagtatactgatagtcgtgtctttgatgtcacggccacaatcgcacggttcattttt |
16700015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 222 - 306
Target Start/End: Complemental strand, 16699972 - 16699888
Alignment:
| Q |
222 |
ttaacctgcagaggaagaagaccaatctaaaggtttcgtcatattttccttaacaaatggccctgagtatcatatctcacaggtt |
306 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16699972 |
ttaacctgtagaggaagaagaccaatctaaaggtttcgtcatattttccttaacaaatggccctgagtatcatatctcacaggtt |
16699888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 126 - 154
Target Start/End: Complemental strand, 38917451 - 38917423
Alignment:
| Q |
126 |
gcggttgtggaccgcaatttaaaaccatg |
154 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38917451 |
gcggttgtggaccgcaatttaaaaccatg |
38917423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University