View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3971_low_5 (Length: 236)
Name: NF3971_low_5
Description: NF3971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3971_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 21394452 - 21394670
Alignment:
| Q |
1 |
tttgtcgtttagtgatgatttaaacggtgtcgtttagttaattt-gattttgtgtatgcattttcagcttaagtcatgatgctatcaacgagcatgcagt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21394452 |
tttgtcgtttagtgatgatttaaacggtgtcgtttagttaattttgattttgtgtatgcattttcagcttaagtcatgatgctatcaacgagcatgcagt |
21394551 |
T |
|
| Q |
100 |
tgataatccagaggagattgcttccatggttgatacgtaataattctatctctcctttaatttaattgagttaattttgtcagtaaaccaattttatcag |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
21394552 |
tgataatccagaggagattgcttccatggttgatacgtaataattctctctctccgttaatttaattgagttaattttgtcaataaacctattttatcga |
21394651 |
T |
|
| Q |
200 |
acaatgtcgatattgttaa |
218 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
21394652 |
acaatgtcgatattgttaa |
21394670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University