View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3974_high_16 (Length: 241)
Name: NF3974_high_16
Description: NF3974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3974_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 53376232 - 53376456
Alignment:
| Q |
1 |
aaaatatgaaggaagatggaaagaatgggagaacctctgttttaggagtgaagaatgaagatggaaacggaggatgattctttgtcagaggttcaaaccg |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
53376232 |
aaaatatgaaggaagatggaaagaaggggagaacctctgttttaggagtgaagaatgaagatggaaacggaggatgattcttcgtcagaggttcaaaccg |
53376331 |
T |
 |
| Q |
101 |
gaacttgaaggagagaggaatgctctgttttctgtttttccttcttcagcggagcgtta-tgcagccgcacgaatcaagaggtaaccctaaacagagatt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
53376332 |
gaacttgaaggagagaggaatgctctgttttctgtttttccctcttcagcggagcgttattgcagccgcacgaatcaagaggtaaccctaaacggagatt |
53376431 |
T |
 |
| Q |
200 |
gatatggtcggaatgcgagggagat |
224 |
Q |
| |
|
|||||||||||||||||| |||||| |
|
|
| T |
53376432 |
gatatggtcggaatgcgatggagat |
53376456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 1 - 152
Target Start/End: Complemental strand, 53403460 - 53403309
Alignment:
| Q |
1 |
aaaatatgaaggaagatggaaagaatgggagaacctctgttttaggagtgaagaatgaagatggaaacggaggatgattctttgtcagaggttcaaaccg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
53403460 |
aaaatatgaaggaagatggaaagaatgggagaacctctgttttaggagtgaagaatgaagatggaaacggaggatgattcttcgtcagaggttcaaaccg |
53403361 |
T |
 |
| Q |
101 |
gaacttgaaggagagaggaatgctctgttttctgtttttccttcttcagcgg |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
53403360 |
gaacttgaaggagagaggaatgctctgttttctgtttttccctcttcagcgg |
53403309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 180 - 224
Target Start/End: Complemental strand, 53403310 - 53403266
Alignment:
| Q |
180 |
ggtaaccctaaacagagattgatatggtcggaatgcgagggagat |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53403310 |
ggtaaccctaaacagagattgatatggtcggaatgcgagggagat |
53403266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University